Traveler J - "Catalyst (Find Him)" [02/08/2007]

[McPackage]

We probably should have made this a separate thread a long time ago, since the title of this one was a previous puzzle that we already solved. Just start a new thread with the summary.

[Luminous]

We probably should have made this a separate thread a long time ago, since the title of this one was a previous puzzle that we already solved. Just start a new thread with the summary.

Duh Great idea McPackage. Done. You can find that new thread here:

http://lonelygirl15.com/forum/viewtopic ... 207#238207

I will move the screen captures over too as soon a I get a chance. I'm pretty sure they are a piece of the puzzle.

[Luminous]

This is from kayokosaeki I asked her to do a frame by frame dissection of the video, and she very graciously accepted. I moved it over from the previous thread where we were working on this so we can keep all the information that has not yet been solved intact.

Below are posted the results she found. Thankyou Kayokosaeki!

I realize I should give you more specific information, to eliminate any confusion. The video we need analyzed is by user WalterDW on Youtube, and it is called "A Proper Introduction" Here's the link -

http://youtube.com/watch?v=SrU0Im9LjNY

We have discovered there are some marks that look like letters roughly stenciled on a chalkboard. So far we have found several A's and several S's. We need to know exactly how many there are, and if there are any others we have missed. Frame count may also be important.

The other thing we have noticed are some dark grey rectangles that mimic film frames going by. This may or may not be important, but if there is a way to count them, we would like to.

And then of course anything else you see that might be a clue.

Again, thank you so much! I'm excited to see what you find

ok, so there are two frames in which a partial "A" appears superimposed over a 36.





then the 36 shifts to appear twice in one frame....



...before a superimposed "S" appears for two frames







then 36 appears again for only 4 frames, just like before only the blacks are darker (i won't post a freeze frame. its just as i say) then 77 appears, shifting once like this



and then 16 frames later the "S" appears again partially



the very end is a fade in and out of the sequence "A" "S" "A" in the same stencil lettering, but i'm going to save my photo bandwidth and not post those freeze frames. its exactly as janesalteredstates posted below

Edit: These are the images were captured from the end of the video by janesalteredstates:







as for the dark grey rectangles that mimic the old film reel, i really see no hidden meaning in them. its just an effect. there's practically one in every frame in the beginning portion (none in the middle or end), but i counted them anyway for you: 47

hope that helps. let me know if you need anything else

[ignatzmouse]

Here is a summary of the "Catalyst (Find Him)" puzzle. It's interesting to see the first use of codon/shifting encryption.

The video is at http://www.youtube.com/watch?v=egMFKctGzoE and the description is:

If we value the pursuit of knowledge, we must be free to follow wherever that search may lead us.

The tags are:

Search 5'3' Restriction FacilityJ OpAphid

The video contains morse code:

Code: Select all

...-- ---.. ---.. ..-. ----. -

which translates to 388F9T which is a tiny url http://tinyurl.com/388F9T resolving to:

Code: Select all

R0dBR1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUd
BVEdHQ0dHQ0NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUN
HQ0dHR0FHVEdBR0dHR0FHQ0FHVFRHR0dDQ0FBR0FUR
0dDR0dDQ0dDQ0dBR0dHQUNDR0dUR0dHQ0dBQ0dHR0
dHQUdUR0FHR0FUQ0NUVFRUVEFUVENUVENHQUNUQ0F
HR0FUQ0NHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0N
HR0NDR0NDR0FHR0dBQ0NHR1RHR0dDR0FDR0dDR0dBR
1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUdBVEdHQ0dHQ0
NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUNHR0dHQUdUR0
FHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0NHR0NDR0N
DR0FHR0dBQ0NHR1RHR0dDR0FDR0NHR0dBR1RHDQoNC
jEoLTQpIDcoLTQpIDggMSAyIDMgOSgtMSkgNCgrMyk=

base64 which converts to

Code: Select all

GGAGTGAGGGGAGCAGTTGGGCCAAGAT
GGCGGCCGCCGAGGGACCGGTGGGCGACGCGG
GAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGC
CGCCGAGGGACCGGTGGGCGACGGGGGAGTGAG
GATCCTTTTTATTCTTCGACTCAGGATCCGGGGAG
CAGTTGGGCCAAGATGGCGGCCGCCGAGGGACC
GGTGGGCGACGGCGGAGTGAGGGGAGCAGTTGG
GCCAAGATGGCGGCCGCCGAGGGACCGGTGGGC
GACGGGGAGTGAGGGGAGCAGTTGGGCCAAGATG
GCGGCCGCCGAGGGACCGGTGGGCGACGCGGGAGTG

1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)

BamHI (a double-cutting restriction enzyme, http://en.wikipedia.org/wiki/Restriction_enzyme) cuts GGATC after the first G, so what is left is:

Code: Select all

GATCCTTTTTATTCTTCGACTCAG

which encodes:

Code: Select all

GAT Aspartic acid
CCT Proline
TTT Phenylalanine
TAT Tyrosine
TCT Serine
TCG Serine
ACT Threonine
CAG Glutamine

which decodes as:

1st position: Aspartic Acid. 1st letter: A. 4 letters back in the alphabet (-4): W

2nd position: Proline. 7th letter: E. 4 letters back in the alphabet: A

3rd position: Phenylalanine. 8th letter: L

4th position: Tyrosine. 1st letter: T

5th position: Serine. 2nd letter: E

6th position: Serine. 3rd letter: R

7th position: Threonine. 9th letter: E. 1 letter back in the alphabet: D

8th position: Glutamine. 4th letter: T. 3 letters forward in the alphabet: W

Putting it all together, we get:

WALTER DW

which takes us to Walter DW's videos and MySpace. Walter's YouTube profile contains hex which decodes to:

It looks like the kid has been somewhat successful, even if altogether reckless. I didn’t expect any better of him. Quite frankly I didn’t think that he was competent for this job, but he is all I have. The same goes for you.

Perhaps some background information is in order. I was in charge of production at Facility J. It took us decades and we only produced nineteen of the damned things. You have taken care of two. The problem is that multiple exposures bring increased risk. So neither I nor the youngster nor any one of you can complete the task alone. The kid told me he had some success on the computer, and this is where we are now. Maybe we can work together in the future, assuming you aren’t screw-ups like he is.