Lonelygirl15

Posted: **Thu Feb 22, 2007 5:09 pm**

autumneternal wrote: I've just been watching you guys on the J Team do your thing, but I had to point out, (and you may already know), but the 'scratches' from the above screenshots are sideways stencils of letters. The 'S' is obvious. The other two letters are 'A'.

Wow I missed the A's. Nice catch. Thanks!

Posted: **Thu Feb 22, 2007 5:12 pm**

autumneternal wrote: I've just been watching you guys on the J Team do your thing, but I had to point out, (and you may already know), but the 'scratches' from the above screenshots are sideways stencils of letters.

Hey, we never claimed to be the "A" team

Most of us are novices. We could really use the help of more experienced players such as yourself. Thanks for the tip. I thought they might be letters, but I was afraid that was too simple.

I did a little research to see what ASA might mean. This is what I've come up with so far:

a.) (ASA) = Argininosuccinic Acidemia, an Amino Acid Disorder

b.) (ASA) = alanine-serine-alanine, a tetramer

c.) Asa = a mans name. The boy's name Asa \a-sa\ is pronounced AY-sah. It is of Hebrew origin, and its meaning is "doctor, healer". Biblical: name of the third king of Judah, who reigned for forty years. Made popular by the Puritans in the 17th century. (We are supposed to be solving for his true identity.)

Posted: **Thu Feb 22, 2007 5:20 pm**

lol, true Lum. I am here to learn

I'm looking it up too.

Apparently it is also an abbreviation for Acetylsalicylic acid which is aspirin.

This one I found interesting: Adaptive simulated annealing

And on this page I found ASA or "Acrylonitrile Styrene Acrylate."

ASA is produced by introducing a grafted acrylic ester elastomer during the copolymerization reaction between styrene and acrylonitrile. Acrylonitrile styrene acrylate material has great toughness and rigidity, good chemical resistance and thermal stability, outstanding resistance to weather, aging and yellowing, and high gloss.

Oh, also, why is the S backward? hmmm

Posted: **Thu Feb 22, 2007 5:27 pm**

This intrigued me. I was looking up some stuff on DNA and found

http://en.wikipedia.org/wiki/Angelman_syndrome

Which is abbreviated "AS."

Has anyone been able to find a genetic disorder that would result in bent bones like the child in the video?

Posted: **Thu Feb 22, 2007 6:07 pm**

I think we'd be better off focusing on the latest puzzle (figuring out Walter's true identity), rather than the "ASA" for now.

Posted: **Thu Feb 22, 2007 6:17 pm**

TOSG wrote:I think we'd be better off focusing on the latest puzzle (figuring out Walter's true identity), rather than the "ASA" for now.

Glad to see you. I think you are the only one so far who has been able to decode these things. I think the next thing up is to look at the sequence through the new perspective.

Posted: **Thu Feb 22, 2007 6:20 pm**

I just noticed that there are similar large letters to those at the end of the video that flash at the beginning of the video (on some of the same frames that the tinyurl address is given). I'm pretty sure that I can make out a V, and maybe another indistinct letter or two.

I don't have a video editing program to get a better look at this, but maybe someone who does should do this.

Posted: **Thu Feb 22, 2007 6:39 pm**

Luminous wrote:Next Steps:
Find Walter's true identity.
WalterDW tells us in his telegram ( http://tinyurl.com/33R59P )
that our next step is to uncover his true identity. In order to do this, he says we will have to "shift our perspective on the sequence that got us here". Most likely, the DNA sequence TOSG decoded:

cgacatatgagcatggcgaccagcaccttcagtgcgcagtgtggcccggagcatcattacctggctgaa
cattcttctatttttaatggcgtcttcagccagcagcttaaaaacaaccttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatcccccccttt

which lead us to the tinyurl above.

I don't know much about these things, but does this mean we now need to look at the RNA sequence? If so, how do we do this?

We have also been given other clues that need to be analyzed - the letters that are stamped on the telegram,

wnhywyry
aaanay
aagwehjjh
nauaj

and possibly the cutoff numbers at the top of the telegram
(looks like 11226 or 11228)

Then there are some strange markings hidden in frames within the "a proper introduction" video http://youtube.com/watch?v=SrU0Im9LjNY

I'm quoting a previous post I made just to bring this information forward. From my best estimate, these are things that need to be looked at to solve this next step. Unfortunately, I am no good at any of them.

Posted: **Thu Feb 22, 2007 6:53 pm**

I entered the ASA in several different arrangements in the tinyurl search and nothing. I switched it around a couple of times and nothing, but they are there for a reason. there is no randomness to this game. Between walter, Cassie, and nancy Drew, oh and the first grade class i taught today, I NEED a drink!!!!

theresa

Posted: **Thu Feb 22, 2007 7:05 pm**

theresascraps wrote: Between walter, Cassie, and nancy Drew, oh and the first grade class i taught today, I NEED a drink!!!!

theresa

The thing I'm working on right now is this:

wnhywyry
aaanay
aagwehjjh
nauaj

I have not idea what kind of code it is or how to decyper it. Any ideas?

Posted: **Thu Feb 22, 2007 7:19 pm**

I am going to write down the words and try to rearrange them so i can see if they form some wort of words, but there are almost too many wierd consonants and vowels are wrong....

theresa

Posted: **Thu Feb 22, 2007 7:26 pm**

theresascraps wrote:I am going to write down the words and try to rearrange them so i can see if they form some wort of words, but there are almost too many wierd consonants and vowels are wrong....

theresa

I agree. That's why I haven't even gone there. I'm wondering if it might be a vigenere cipher:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

If so, what would the key be?

Also, if it's not a vigenere cipher, I wonder what sort of code might use the numbers 11226( 8 ) as a key?

Posted: **Thu Feb 22, 2007 8:15 pm**

Here is a tool Trainer101 suggested might help us solve the cipher.

http://rumkin.com/tools/cipher/index.php

Posted: **Thu Feb 22, 2007 8:40 pm**

Luminous wrote:Next Steps:
Find Walter's true identity.
WalterDW tells us in his telegram ( http://tinyurl.com/33R59P )
that our next step is to uncover his true identity. In order to do this, he says we will have to "shift our perspective on the sequence that got us here". Most likely, the DNA sequence TOSG decoded:

cgacatatgagcatggcgaccagcaccttcagtgcgcagtgtggcccggagcatcattacctggctgaa
cattcttctatttttaatggcgtcttcagccagcagcttaaaaacaaccttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatcccccccttt

which lead us to the tinyurl above.

I don't know much about these things, but does this mean we now need to look at the RNA sequence? If so, how do we do this?

We have also been given other clues that need to be analyzed - the letters that are stamped on the telegram,

wnhywyry
aaanay
aagwehjjh
nauaj

and possibly the cutoff numbers at the top of the telegram
(looks like 11226 or 11228)

Then there are some strange markings hidden in frames within the "a proper introduction" video http://youtube.com/watch?v=SrU0Im9LjNY

Thanks for the summary--this is pretty hard to follow otherwise. I just wanted to point out that it looks like you typed an extra "y" in the first line of the stamp text.

Luminous wrote:I cropped the stamp and the number on the upper right of the telegram, and enhanced the contrast a bit. Looks like they're probably clues:

Posted: **Thu Feb 22, 2007 8:44 pm**

Weepel wrote:
Thanks for the summary--this is pretty hard to follow otherwise. I just wanted to point out that it looks like you typed an extra "y" in the first line of the stamp text.

Good Catch! Thanks! That's the kind of oversight that could keep me doing this

for days

Lonelygirl15

Traveler J - "Catalyst (Find Him)" [02/08/2007]