Page 2 of 11

Posted: Sun Feb 11, 2007 4:44 pm
by Luminous
Here is something I did based on the link to the neb site from blablablee above. I input the gene letter sequence that was decoded and got this result.

Image

Then I clicked on 2 cutters (because double edged swords cut twice)under "list" and got this result :

Image

But all of this may be total nonsense, because I have no clue what I'm doing :)

Here is a new message I just received from Traveler:

Image

We are looking for DNA, not RNA. The correct restriction enzyme, which is what we need to isolate may "Dash before your eyes""If you can count that"

I think this might be a reference to a couple of short sequences that "dash" by really fast in the video "catalyst(find him)".

One is of the briefcase that was sent to McPackage, the other is of someone in a dress shirt pouring something from one test tube into another - possibly the evidence of TravelerJ destroying "J1".

Anyway, I think if we count the dashes in these two sequences, it may point us to the answer we are looking for. Possibly it's morse code? Or maybe just a number we need.

I downloaded the footage so I could isolate the sequences and slow them down, making it easier to count the dashes, I'm not going to be able to get to it until later this evening.

On the subject of "WD, find him".

I'm wondering if that could that be a reference to "W. D. Hardt"? He's a real person though, not a character, so maybe not. But then again, possibly it is his research that we are supposed to be looking into.

Posted: Sun Feb 11, 2007 5:40 pm
by TOSG
BamHI is a very commonly used restriction enzyme - that might be a good candidate.

Let me know if you find anything in the video's flashes.

Posted: Mon Feb 12, 2007 3:09 am
by Luminous
Sorry I haven't posted the edited video yet. My editing program crashed, and I've spent the evening troubleshooting. No luck yet. Hopefully I'll have something by tomorrow.

Posted: Mon Feb 12, 2007 2:44 pm
by Brucker
I almost hate to suggest it, but since a restriction anzyme works on both sides of the DNA strand, it might be that the code is on the other side, which would be

CCTCACTCCCCTCGTCAACCCGG
TTCTACCGCCGGCGGCTCCCTGG
CCACCCGCTGCGCCCTCACTCCC
CTCGTCAACCCGGTTCTACCGCC
GGCGGCTCCCTGGCCACCCGCTG
CCCCCTCACTCCTAGGAAAAATAA
GAAGCTGAGTCCTAGGCCCCTCGT
CAACCCGGTTCTACCGCCGGCGG
CTCCCTGGCCACCCGCTGCCGCC
TCACTCCCCTCGTCAACCCGGTTC
TACCGCCGGCGGCTCCCTGGCCA
CCCGCTGCCCCTCACTCCCCTCGT
CAACCCGGTTCTACCGCCGGCGGC
TCCCTGGCCACCCGCTGCGCCCTCAC

Once again, not having a very full understanding of genetic coding principles, if this is the case, I'm not sure if you'd then also process the strand from right to left at your starting point?

Posted: Mon Feb 12, 2007 2:53 pm
by TOSG
Brucker wrote: Once again, not having a very full understanding of genetic coding principles, if this is the case, I'm not sure if you'd then also process the strand from right to left at your starting point?
Sort of. What you would actually look at is the reverse complementary strand: it's the given sequence backwards, and with each base replaced by its pairing partner (G--->C; A--->T). There are programs that will make this switch automatically. In fact, the restriction analysis that Luminous posted takes into account both the given sequence and its complement. (EDIT: Actually, upon further investigation, it might not.)

Good thinking, though - it seems quite possible that this could be part of the puzzle.

Edit: I see what you're saying...yes, you would reverse the sequence.

Posted: Mon Feb 12, 2007 2:56 pm
by Brucker
Okay, and just for good measure, here's the list offset by one:

Code: Select all

GAG	Glutamic acid
TGA	STOP
GGG	Glycine
GAG	Glutamic acid
CAG	Glutamine
TTG	Leucine
GGC	Glycine
CAA	Glutamine
GAT	Aspartic acid
GGC	Glycine
GGC	Glycine
CGC	Arginine
CGA	Arginine
GGG	Glycine
ACC	Threonine
GGT	Glycine
GGG	Glycine
CGA	Arginine
CGC	Arginine
GGG	Glycine
AGT	Serine
GAG	Glutamic acid
GGG	Glycine
AGC	Serine
AGT	Serine
TGG	Tryptophan
GCC	Alanine
AAG	Lysine
ATG	Methionine or START
GCG	Alanine
GCC	Alanine
GCC	Alanine
GAG	Glutamic acid
GGA	Glycine
CCG	Proline
GTG	Valine
GGC	Glycine
GAC	Aspartic acid
GGG	Glycine
GGA	Glycine
GTG	Valine
AGG	Arginine
ATC	Isoleucine
CTT	Leucine
TTT	Phenylalanine
ATT	Isoleucine
CTT	Leucine
CGA	Arginine
CTC	Leucine
AGG	Arginine
ATC	Isoleucine
CGG	Arginine
GGA	Glycine
GCA	Alanine
GTT	Valine
GGG	Glycine
CCA	Proline
AGA	Arginine
TGG	Tryptophan
CGG	Arginine
CCG	Proline
CCG	Proline
AGG	Arginine
GAC	Aspartic acid
CGG	Arginine
TGG	Tryptophan
GCG	Alanine
ACG	Threonine
GCG	Alanine
GAG	Glutamic acid
TGA	STOP
GGG	Glycine
GAG	Glutamic acid
CAG	Glutamine
TTG	Leucine
GGC	Glycine
CAA	Glutamine
GAT	Aspartic acid
GGC	Glycine
GGC	Glycine
CGC	Arginine
CGA	Arginine
GGG	Glycine
ACC	Threonine
GGT	Glycine
GGG	Glycine
CGA	Arginine
CGG	Arginine
GGA	Glycine
GTG	Valine
AGG	Arginine
GGA	Glycine
GCA	Alanine
GTT	Valine
GGG	Glycine
CCA	Proline
AGA	Arginine
TGG	Tryptophan
CGG	Arginine
CCG	Proline
CCG	Proline
AGG	Arginine
GAC	Aspartic acid
CGG	Arginine
TGG	Tryptophan
GCG	Alanine
ACG	Threonine
CGG	Arginine
GAG	Glutamic acid
...and offset by two:

Code: Select all

CODON	Base
AGT	Serine
GAG	Glutamic acid
GGG	Glycine
AGC	Serine
AGT	Serine
TGG	Tryptophan
GCC	Alanine
AAG	Lysine
ATG	Methionine or START
GCG	Alanine
GCC	Alanine
GCC	Alanine
GAG	Glutamic acid
GGA	Glycine
CCG	Proline
GTG	Valine
GGC	Glycine
GAC	Aspartic acid
GCG	Alanine
GGA	Glycine
GTG	Valine
AGG	Arginine
GGA	Glycine
GCA	Alanine
GTT	Valine
GGG	Glycine
CCA	Proline
AGA	Arginine
TGG	Tryptophan
CGG	Arginine
CCG	Proline
CCG	Proline
AGG	Arginine
GAC	Aspartic acid
CGG	Arginine
TGG	Tryptophan
GCG	Alanine
ACG	Threonine
GGG	Glycine
GAG	Glutamic acid
TGA	STOP
GGA	Glycine
TCC	Serine
TTT	Phenylalanine
TTA	Leucine
TTC	Phenylalanine
TTC	Phenylalanine
GAC	Aspartic acid
TCA	Serine
GGA	Glycine
TCC	Serine
GGG	Glycine
GAG	Glutamic acid
CAG	Glutamine
TTG	Leucine
GGC	Glycine
CAA	Glutamine
GAT	Aspartic acid
GGC	Glycine
GGC	Glycine
CGC	Arginine
CGA	Arginine
GGG	Glycine
ACC	Threonine
GGT	Glycine
GGG	Glycine
CGA	Arginine
CGG	Arginine
CGG	Arginine
AGT	Serine
GAG	Glutamic acid
GGG	Glycine
AGC	Serine
AGT	Serine
TGG	Tryptophan
GCC	Alanine
AAG	Lysine
ATG	Methionine or START
GCG	Alanine
GCC	Alanine
GCC	Alanine
GAG	Glutamic acid
GGA	Glycine
CCG	Proline
GTG	Valine
GGC	Glycine
GAC	Aspartic acid
GGG	Glycine
GAG	Glutamic acid
TGA	STOP
GGG	Glycine
GAG	Glutamic acid
CAG	Glutamine
TTG	Leucine
GGC	Glycine
CAA	Glutamine
GAT	Aspartic acid
GGC	Glycine
GGC	Glycine
CGC	Arginine
CGA	Arginine
GGG	Glycine
ACC	Threonine
GGT	Glycine
GGG	Glycine
CGA	Arginine
CGC	Arginine
GGG	Glycine
AGT	Serine

Posted: Mon Feb 12, 2007 3:00 pm
by Luminous
I'm still troubleshooting my editing program, so I don't yet have a clip to post, but I wanted to mention that in "History Lessons (Coded Rings)" it is pointed out that "the gene of interest is a 'Toxic' gene".

Posted: Mon Feb 12, 2007 3:03 pm
by kellylen
if i remember correctly from last semester about DNA, a DNA sequence usually completely ends at a series of As. like A LOT of As.

Posted: Mon Feb 12, 2007 3:04 pm
by TOSG
kellylen wrote:if i remember correctly from last semester about DNA, a DNA sequence usually completely ends at a series of As. like A LOT of As.
You're thinking of (human) mRNA.

Posted: Mon Feb 12, 2007 3:07 pm
by TOSG
This is interesting: the following motif "GGAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGCCGCCGAGGGACCGGTGGGCGACG" repeats 4 times within the sequence.

Posted: Mon Feb 12, 2007 3:25 pm
by TOSG
I think I'm getting somewhere here... when I cut out the portion of the gene that would be removed by using BamHI (a double-cutting restriction enzyme), nearly all that remains is the 4 repeats of the sequence that I gave above. This repeat comes directly from human nucleoporin DNA. The sequence that would be cut out by BamHI has no significant homology with any other known gene.

Thus, it seems clear that the sequence is composed of two different elements: a repeating sequence from human nucleoporin DNA, and an insert by TravelerJ. I think that it's likely that one of these is significant, and the other is meant to be disregarded.

What do you guys make of this? What, exactly, do you think we're trying to find?

(If someone is willing to bring me up to speed on AIM or somesuch, send me a PM).

Posted: Mon Feb 12, 2007 3:41 pm
by Brucker
TOSG wrote:This is interesting: the following motif "GGAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGCCGCCGAGGGACCGGTGGGCGACG" repeats 4 times within the sequence.
It's bound to be significant. FYI, the reverse compliment is:

Code: Select all

CCT	Proline
CAC	Histidine
TCC	Serine
CCT	Proline
CGT	Arginine
CAA	Glutamine
CCC	Proline
GGT	Glycine
TCT	Serine
ACC	Threonine
GCC	Alanine
GGC	Glycine
GGC	Glycine
TCC	Serine
CTG	Leucine
GCC	Alanine
ACC	Threonine
CGC	Arginine
TGC	Cysteine

Posted: Mon Feb 12, 2007 4:03 pm
by TOSG
Brucker: the reverse complement goes from right-to-left, not left-to-right.

I actually tend to think that the important part isn't the repeating unit, but rather what TravelerJ inserted into the middle (flanked by BamHI cut sites). I'm a bit confused, though, about where to go from here - there's some stuff that I could play around with, but if anyone has any clear ideas what we might be looking for (a word (or tinyurl) coded into the one-letter abbreviated protein sequence? That's about the only thing that comes to my mind), then don't be shy.

Posted: Mon Feb 12, 2007 4:11 pm
by Luminous
TOSG wrote: What do you guys make of this? What, exactly, do you think we're trying to find?
I think we are trying to find a 5'3' restriction enzyme (DNA, not RNA) that is a "double edged sword" (in otherwords it cuts twice). That it is a "Toxic Gene", and that it can somehow be identified by counting the number of flashes in the two short clips from the most recent video.

I don't know much about genetics, so I'm lost in how to take these clues and put them to any practical use. There are more clues in the various videos as well. I'm working on compiling a list of everything I think might be a clue.

I think we are also looking for WD - someone who has more information about what went down at FacilityJ than Traveler does.

We have a profile of him (shown at the end of the second Catalyst video). Who is he and how do we find him? My research came up with a well published geneticist named W.D. Hardt. I don't know if he's the guy we're looking for or not. He's a real guy, not a fictional character. Maybe Traveler J is trying to point us toward Hardt's research.

Posted: Mon Feb 12, 2007 4:23 pm
by TOSG
Luminous: Cool, I'm looking forward to that list.

Just so that everyone knows, a restriction enzyme is a protein that cuts a DNA sequence in a specific location. The terms "5'3'," and "toxic gene" almost certainly refer to the DNA itself. "Double-edged sword" almost certainly refers to the restriction enzyme that is operating upon the DNA.

WD Hardt appears to be a "real-life" German microbiologist/immunologist. His work, while apparently fairly impressive (just judging from a list of his published articles and which journals they went into), doesn't seem immediatly noteworthy. What led you to his name?