Facility J [Drop Contents] - "Dei Sub Numine Viget"

chershaytoute · Post by **chershaytoute** » Sat Mar 24, 2007 7:25 pm

Bless you, Z! 'zactly what I was just thinking, obviously!

I'll be Goober to your Dork any day...or am I being Dork to your Goober...or...hmmmm...

janesalteredstates · Post by **janesalteredstates** » Sat Mar 24, 2007 11:48 pm

cure for mankind

I don't think Walter is a man at all.

chershaytoute · Post by **chershaytoute** » Sun Mar 25, 2007 12:57 am

Holy ohmygosh! Now, that would be something... But Traveler J19 referred to Walter has him...so we have a third party reference...?

janesalteredstates · Post by **janesalteredstates** » Sun Mar 25, 2007 3:09 pm

Wait.
Holy crap.

OK, "the cure" for XSCID is the X chromosome, if we were talking all poetically or trying to be obtuse. No? Does that make any sense?

I don't even have a good theory about this, it just popped into my head. "Cure for mankind."

If women are the cure... ?

I know we have not been destroying women

I'm just thinking out loud (well, writing what I am thinking without thinking about it.)

Luminous · Post by **Luminous** » Sun Mar 25, 2007 3:15 pm

janesalteredstates wrote:Wait.
Holy crap.

OK, "the cure" for XSCID is the X chromosome, if we were talking all poetically or trying to be obtuse. No? Does that make any sense?

I don't even have a good theory about this, it just popped into my head. "Cure for mankind."

If women are the cure... ?

I know we have not been destroying women I'm just thinking out loud (well, writing what I am thinking without thinking about it.)

Maybe "J" is THE CURE for "men" being "kind" - or for being men

Edit: Because I made absolutely no sense - synapses were'nt firing yet this morning.

janesalteredstates · Post by **janesalteredstates** » Sun Mar 25, 2007 3:18 pm

Are you making fun of me?

chershaytoute · Post by **chershaytoute** » Sun Mar 25, 2007 4:59 pm

Please point me again for re-reading on XSCID?

That sounds like an intriguing point to explore, but...can't explore if I can't remember where, and from the feel of it, I have a migraine approaching... <sigh>

janesalteredstates · Post by **janesalteredstates** » Sun Mar 25, 2007 5:13 pm

chershaytoute wrote:Please point me again for re-reading on XSCID?

That sounds like an intriguing point to explore, but...can't explore if I can't remember where, and from the feel of it, I have a migraine approaching... <sigh>

No problemo. Sorry about your migraine. I get those too

Awful things.

OK, here you go:

This Side of Paradise

deagol's amazingly thorough explanation of how we cam upon XSCID
After that you'll find posts about the disorder(? is it a disorder? Defect?).

Hope that helps.

And take some pain killers.

Edit - We need to update the JPedia. Especially the puzzle recaps. *runs away*

Luminous · Post by **Luminous** » Sun Mar 25, 2007 5:27 pm

janesalteredstates wrote: Edit - We need to update the JPedia. Especially the puzzle recaps. *runs away*

Hope you're running away to make the needed edits

Everyone, feel free to join in - it's a big job keeping this thing up to date!

janesalteredstates · Post by **janesalteredstates** » Sun Mar 25, 2007 5:34 pm

Uhm... yeah, that's what I did.

No, seriously, when I finish this ridiculous Logic homework

I'll see what I can do.

deagol · Post by **deagol** » Sun Mar 25, 2007 6:23 pm

Logic HW? need any help?

janesalteredstates · Post by **janesalteredstates** » Sun Mar 25, 2007 6:59 pm

Are you familiar with Symbolic Logic? (maybe this should be a PM thing

)

ignatzmouse · Post by **ignatzmouse** » Mon Apr 09, 2007 8:54 pm

A summary of the "Dei Sub Numine Viget" puzzle. This seemed a lot harder at the time

Drop contents:

1 white envelope
1 plastic bag
8 stones (looks like granite pebbles)
2 vials (J-5 and J-6)
1 library catalog card

On the outside of the envelope it says "From Debrowski." The front of the library card catalog says:

(SQ)
QD40
.I536
1985

International Conference on Chemical
Education (8th : 1985 : Tokyo,
Japan) Widening the scope of
Chemistry... 1987.

Union of Pure and Applied Chemistry in
conjunction with the Chemical Society
of Japan"--P. [ii].
Includes bibliographies.
ISBN 0-632-01537-3

1. Chemistry--Study and teaching --
Congress. I. Takeuchi, Yoshito.
1934- II. International Union of
Pure and applied Chemistry. III.
Nihon Kagakkai, IV. Title.

870623 870622 NjP
ZG /ZG A* 87-B28379
86-26421

SQm
E000271

On the back it says (all hand written):

Code: Select all

You should know what to do. I suppose it is time to tell you that what you have been destroying is
IKYOIYK
1(+ 8) 3(- 8) 5(+ 16) 3(- 16) 6(+ 16) 2(- 16) 7(+ 24)

There are eight stones, and the book is the 8th ICCE conference. Walter gave us a series of hints:

(The shift +24) provides a multiplicity of clues.
Your comments aren't entirely off base.
It is tough being an Octalgenarian.
You kids may be young now, but you will eventually Convert to be like me, no matter how Plain you start.

Converting the text IKYOIYK into octal gives:

Code: Select all

111113131117111131113

Reading this as 1=A, 2=B, 3=C, etc. gives:

Code: Select all

AAAAACACAAAGAAAACAAAC

which codon/shift decrypts as:

Code: Select all

Lysine_Asparagine_Threonine_Lysine_Lysine_Threonine_Asparagine (aminoacid names)
1        3            5       3         6  2              7    (number code)
LPOSEHG
+8 -8 +16 -16 +16 -16 +24 (shifts)
THECURE

So we are destroying "The Cure".