[Puzzle] JayNineteen Youtube Profile Update [5/7/07]

[deagol]

What was I getting with the 6-times encrypt?

I will call my lucky 6-times result D, with D(i) a particular letter in the sequence. A is the ijoopy string, B is the everyman text, and dna is a dna sequence. Here's why I was getting a limited set of letters, including rot13 pairs:

Code: Select all

dna = A - 2*B          --this is the solution iMouse found
A = dna + 2*B          --this is how the ijoopy string is formed
D = 6*A + B            --this is what I was doing with ijoopy and everyman
 = 6*(dna + 2*B) + B     --substituting A from above
 = 6*dna + 13*B            --expand and simplify
6*dna = 6*[acgt] = [amkk]    --possible letters for the first term
 13*B = 13*[abcd...wxyz] = [anan...anan]    --letters for the second term
 
dna(i)[acgt] -> D(i) = [amkk] for B(i) even (a,c,e,g,etc are even)
                     = [nzxx] for B(i) odd  (b,d,f,h,etc are odd)
    --there wasn't any z, and just a couple of m's due to this particular dna and english text combination.

Now, I can't see any clue for us to do the double-decrypt, not even in hindsight. If we are supposed to try every possible trick, with multiple vigenere passes, without any clue or even an obscure hint about it, I'm afraid I wont even start trying anything until people start PMing the character.

Sorry, but I'm only game if there's some sort of logic pointing to a viable path towards a solve, just a slight hint for it would be fine (2x, do-over, rpt, iter, 1-800-HOWTOSHAMPOO, I'd take anything). The last 2 puzzles have left me with a bad taste, but the worst is, character interaction gets reduced to shilling, which is pretty unfortunate.
[/rant]

[ignatzmouse]

Now, I can't see any clue for us to do the double-decrypt, not even in hindsight. If we are supposed to try every possible trick, with multiple vigenere passes, without any clue or even an obscure hint about it, I'm afraid I wont even start trying anything until people start PMing the character.

Sorry, but I'm only game if there's some sort of logic pointing to a viable path towards a solve, just a slight hint for it would be fine (2x, do-over, rpt, iter, 1-800-HOWTOSHAMPOO, I'd take anything). The last 2 puzzles have left me with a bad taste, and character interaction gets reduced to shilling, which is unfortunate.

As I see it, we were meant to think as follows...

First, we try "the obvious", i.e. use "everymanandwomanisastar" as the decrypt key for "ijoop..." which fails, but we note that the key is longer than the ciphertext. So we look to see what's left over, which is "star". Oh look, our clue is "(everymanandwomanisa)star", and reading "star" as "repeat zero or more times" we try repeated decryption, and ta-dah.

I don't think this is as bad as you do -- my main complaint is that (if my reading of the clue is correct) we're suddenly using computer science terminology rather than biochemistry.

[ignatzmouse]

YESS! it went through! waiting for him to approve now.

Excellent work iMouse.

Thank you -- the basic idea is yours, I just tweaked it. Do you never sleep?

[ignatzmouse]

And a bit more post-game analysis...

The encryption was given as:

Code: Select all

  atggtaaattttacatgctggtga
+ everymanandeverywomanisa
+ everymanandeverywomanisa
= ijoopyaattzbqkipyerggjqa

and note that:

Code: Select all

  everymanandeverywomanisa
+ everymanandeverywomanisa
= iqiiwyaaaagiqiiwscyaaqka

so another way of viewing the problem is:

Code: Select all

  atggtaaattttacatgctggtga
+ iqiiwyaaaagiqiiwscyaaqka
= ijoopyaattzbqkipyerggjqa

which is remarkably like a one-time pad with a random key, hence all our cryptanalysis was failing.

Also, shifting the key right by 11 characters:

Code: Select all

iqiiwyaaaagiqiiwscyaaqka
           iqiiwyaaaagiqiiwscyaaqka

we get 7 out of 11 matches, which is why we were getting all those false leads for 11-character keys.

Also also, note that there's a lot of repeated characters in "iqiiwyaaaagiqiiwscyaaqka": the 5 letters {a,i,q,w,y} make up 20 of the 24 letters. Hence the skewed frequency distribution of the ciphertext.

All in all, I think we did a good job of attacking the problem, and we now have a collection of tools for analysing Vigenere-encrypted {A,C,G,T} sequences. Er, I'm sure that'll come in useful at parties.

[deagol]

Well if that's the correct clue, I'll admit it went right over my head, and I know what a regular expression is. Even after you pointed the star = iterate connection, I thought it was a bit of a stretch. They're just very different processes to me, with quite different actions associated with "star". grep is a search operation, where the star means search for a repeated pattern. Here we have the star used to imply the repetition of a whole procedure, an operation, with inputs and outputs and manipulating a string and changing it. A much more appropriate reference would have been something like "for i must hold my tongue" (from Hamlet), with the key "mustholdmytongue" to be applied repeatedly.

Oh, and the obvious thing for me was having the ijoopy as the key and the everyman as the message to encode into dna.

"There is nothing more deceptive than an obvious fact." --Sherlock Holmes, in "The Boscombe Valley Mystery"

[deagol]

So we have the jnineteen VECTOR...

Vector (biology)

In gene therapy, a virus itself may serve as a vector, if it has been re-engineered and is used to deliver a gene to its target cell. A "vector" in this sense is a vehicle for delivering genetic material such as DNA to a cell.

There is a possibility for confusion between the use of "vector" in gene therapy and its use in molecular biology more generally. Some transformation technologies, such as lipofectamine, enable the direct delivery of a DNA construct as therapy in a tissue. In such a situation, a plasmid vector may be regarded as serving as its own gene-therapy vector. When a speaker calls it "a vector," they may be referring to either of its vector aspects or often both.

I guess we're still in the biochemistry/genetics realm.

[TOSG]

GREAT work, guys. I do wonder if that "star = iterate" bit was intentional or serendipetous. Hopefully the former.

OOG, I do think that this is a different PM (gamejacker, whatever you want to call it). The style of the puzzle just seems to be quite different. But, I'm fine with giving him the benefit of the doubt, and to judge him based on the subsequent puzzles which he designs.

Deagol, keep us posted about the myspace! And, thankfully, "vector" falls within my (sadly narrow) area of expertise, so if anyone has any biology questions, feel free to ask away.

[ignatzmouse]

Well if that's the correct clue, I'll admit it went right over my head, and I know what a regular expression is. Even after you pointed the star = iterate connection, I thought it was a bit of a stretch. They're just very different processes to me, with quite different actions associated with "star". grep is a search operation, where the star means search for a repeated pattern. Here we have the star used to imply the repetition of a whole procedure, an operation, with inputs and outputs and manipulating a string and changing it. A much more appropriate reference would have been something like "for i must hold my tongue" (from Hamlet), with the key "mustholdmytongue" to be applied repeatedly.

Oh, and the obvious thing for me was having the ijoopy as the key and the everyman as the message to encode into dna.

"There is nothing more deceptive than an obvious fact." --Sherlock Holmes, in "The Boscombe Valley Mystery"

Well, this is me reverse engineering the clue from the solution, but...

A related meaning for "star" from relational algebra is "reflexive transitive closure". If R is a relation (e.g. in this case "decrypt with key ijoop...") then R* is the relation given by repeated application of R.

So this meaning of star is out there, just in a field completely unrelated to biochem, which has been the source of the Facility J puzzles up until now.

[ignatzmouse]

GREAT work, guys.

Thanks!

OOG, I do think that this is a different PM (gamejacker, whatever you want to call it).

Indeed. Gamejack in progress. Hey ho, if it was good enough for OpAPHID...

[deagol]

It's amazing, and even a bit frustrating, to see how close we got at some points:

All the way back from the first page, a week ago:

So here's what we've tried so far in chat:
...
Message: ijoopyaattzbqkipyerggjqa
Pass: Everymanandeverywomanisastar
Result: eokxrmantgwxvgrrcqfgtbya
...

Grrr... just one more time Lum!

The next day:

OK, next bit of cryptanalysis that doesn't get us a result...
...

Code: Select all

a ijoopyaattzbqkipyerggjqa
c ghmmnwyyrrxzoignwcpeehoy 
g cdiijsuunntvkecjsylaadku
t pqvvwfhhaagixrpwflynnqxh

And there's the right key, of course:

Code: Select all

k iqiiwyaaaagiqiiwscyaaqka
s atggtaaattttacatgctggtga

iMouse got real close when using my decoding table:

Trying the shifting trick on deagol's block:
...

Code: Select all

a:srmmlcaahhbzkqslcwjuurka
c:utooneccjjdbmsuneylwwtmc
g:yxssriggnnhfqwyricpaaxqg
t:lkffevttaausdjlevpcnnkdt
                          
           a:srmmlcaahhbzkqslcwjuurka
           c:utooneccjjdbmsuneylwwtmc
           g:yxssriggnnhfqwyricpaaxqg
           t:lkffevttaausdjlevpcnnkdt
                          
             sksseeccaa---

and indeed the encryption key "sksseeccaab" produces the output "atggtcccttatacatcgtggkik". But I doubt this is our secret star.

Compare:

Code: Select all

what you got: sksseeccaabsksseeccaabsk
the real key: skssecaaaausksseiycaakqa

output: atggtcccttatacatcgtggkik
solutn: atggtaaattttacatgctggtga
        ^^^^^   ^^ ^^^^^  ^^^

15/24 (>62%) bases correct.

Reason for the length-11 false key (iMouse already mentioned this but using the iqiiwy key, and I thought in plain english would be clearer):

Code: Select all

everymanandeverywomanisa
           everymanandeverywomanisa
           ^^^^^   ^^

A bit later, Lum always asking the right questions:

...
ATG = M - Start codon - so that makes sense.
...
KIK = ?
...
1. What would it take to turn KIK into a stop codon to balance the ATG start codon, and how would that affect the rest of the sequence?

And:

Seems like the problem is that the frequency of the phrase/key don't match to produce a sequence of codons - hope this analysis is correct.

This makes me wonder - If Jay wanted to mask the frequency in order to make things more challenging to decode, what kind of strategies might he use? Sorry I don't have any answer for this - I'm better at coming up with questions lol

D'oh, double-bag it!

If it were a one time pad though, it seems like he would find a way to provide the key. In the past the key has always been provided. I can't imagine we would be expected to guess it - at least I would hope not

It's almost like getting help from Jay himself!

Lum & Kit:

heh maybe cuz I never hear it lol

[17:31] <@LumBack> K, so what I was thinking about the puzzle.
[17:31] <@LumBack> I was thinking that the Crowley references identify the keys
[17:31] <@LumBack> and that the ijoopy . . . . is the message text
[17:32] <@LumBack> cause it syncs mathmatically with the decrypt numbers.
[17:32] <@LumBack> either 4 to each #(+#)
[17:32] <@LumBack> or three to the #'s with a start and stop codon.
[17:33] <@LumBack> So, hang on, I'm getting something.
[17:34] <@LumBack> So when we use Every man and every woman is a star
[17:34] <@LumBack> to decrypt ijoopyaattzbqkipyerggjqa
[17:34] <@LumBack> we get eokxrmantgwxvgrrcqfgtbya
[17:34] <@LumBack> Which is, as best we can tell, nonsense.
[17:35] <@LumBack> So I was looking at that and wondering
[17:35] <@LumBack> If Jay wanted to make a harder puzzle
[17:35] <@LumBack> so Deag and Mouse couldn't just crack it immediately
[17:35] <@LumBack> how would he mask the sequence
[17:35] <@LumBack> so they couldn't force decrypt it?
[17:36] <@SultryKitten> so you think we need to decrypt that again with the other crowely thing?
[17:36] <@LumBack> Anyway, that's as far as I got

in case someone can finish before I get the chance to tonight.

We were thinking maybe we need to decrypt it again with our second crowely hint.

Holy sh*t, why didn't you! I would've been able to sleep soundly last night, instead of waking up at 3 am screaming "iterate, irate!", and then iterating 6 times in the wrong direction, and with interspersed rot13 chars... grrr!

I'm now convinced Lum's behind this gamejack!

[ShardinsKitten]

lol yea I got so busy last night, I didn't have a chance to finish it up. Me and her were going over the definition and trying to figure out what to repeat for awhile in chat, I just didn't want to bog the thread down with a huge chat log lol. I wish I would have had had the time to do it lol.

Lum is a lot better at this stuff then she thinks that's for sure.

[Musique]

Great job for cracking Jay's code on his MySpace... but what about his YouTube message? I see it's been removed, and replaced with a 05/26. Think this means we need to decipher that message before May 26th?

[ignatzmouse]

A summary of the youtube profile puzzle...

The original puzzle was spotted by Musique:

"Every man and every woman is a star."

ijoopyaattzbqkipyerggjqa

060060061061060061060060040060 060061060061060060060040060060 061060061060061061040060060061 061060060060061040060060061061 060060061061040060060061060061 060060061040060060061060060060 060060040060060061061060060060 061040060060061060061060060060 040060060061060061060061061040 060060061061060061060060040060 060061060061060060061040060060 061060060060060060040060060061 061061060060060040060060061060 061060060060040060060061060061 060061061040060060061061060060 060061040060060061061060061061 061040060060061060061060060061 040060060061060060060060060040 060060061061060061060060040060 060061060061060060060040060060 061060061061060061040060060061 061060060060061040060060061061 060060060061040060060061060061 060060061040060060061060060060 060060040060060061061060060060 061040060060061060061060060060 040060060061060061061060061040 060060061061060060060061040060 060061061060061060060040060060 061060061060060061040060060061 060060060060060040060060061061 061060060060040060060061060061 060060060040060060061060061061 060061040060060061061060060060 061040060060061061060061061060 040060060061060061060060061

decoded as:

Octal ---> ASCII Text:

00110100 00101000 00101011 00110001 00110011 00101001 00100000 00110001 00101000 00101011 00110100 00101001 00100000 00111000 00101000 00101011 00110001 00110111 00101001 00100000 00110100 00101000 00101101 00110001 00110001 00101001 00100000 00110001 00101000 00101101 00110001 00110100 00101001 00100000 00111000 00101000 00101101 00110001 00110110 00101001

Binary ---> ASCII Text:

4(+13) 1(+4) 8(+17) 4(-11) 1(-14) 8(-16)

The quote is from Crowley.

After a lot of cryptanalysis and key-guessing went nowhere, we resorted to begging letters:

To: JayNineteen
Sent: May 12, 2007
Read: —
Subject: ijoopyaattzbqkipyerggjqa
Message:
The volunteer corps has been going crazy over your profile.
Going crazy, I say crazeeeee!
All attempts at decryption have gone nowhere.
Can you give us a hint?
?

and got the reply:

Sent: May 12, 2007
Subject: Re: ijoopyaattzbqkipyerggjqa
Message:
iterate

Deagol then suggested trying repeated decryptions, from which we got:

key := everymanandeverywomanisa
msg := ijoopyaattzbqkipyerggjqa
FOR iteration = 1 TO 2
msg := decrypt (msg, key)
print (iteration+":"+msg)
ENDFOR

Output:
1:eokxrmantgwxvgrrcqfgtbya
2:atggtaaattttacatgctggtga

ATG is a start codon, TGA is a stop codon, the rest decrypts using "the usual codon/shift scheme" to VECTOR which is JayNineteen's myspace password.

In retrospect, "every man and woman is a star" can be read as "(every man and woman is a) star" meaning to repeat "every man and woman is a" as the key. (Star means "repeat" in computer science / regular expressions / relational algebra.)

[ignatzmouse]

Great job for cracking Jay's code on his MySpace... but what about his YouTube message? I see it's been removed, and replaced with a 05/26. Think this means we need to decipher that message before May 26th?

I just posted the solution summary, getting ready to update the JPedia! It is as cracked as only a bull in a china shop could rival

[Musique]

You mean... all of THAT turned out to be one word?


Damn, you guys are good.